rs3806235 chr1:100249898 G>A
- Sequence
ggcctatcaggagatgggaaacgc[G/A]cctccccctgggcgaccaataggg
- ASB in cell types
- K562 (myelogenous leukemia) cranial neural crest cells upper lobe of left lung breast tumor tissue
- ASB for transcription factors
- AP2A_HUMAN ESR1_HUMAN KDM1A_HUMAN NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | n/a | 2.75 | 2.00 | n/a | No Hit | |||
| ESR1_HUMAN | n/a | 2.37 | 2.50 | n/a | No Hit | |||
| KDM1A_HUMAN | -0.58 | 1.86 | 1.33 | n/a | n/a | |||
| NFIC_HUMAN | -1.54 | 1.33 | 1.33 | n/a | No Hit | |||
| MYBB_HUMAN | -2.04 | 2.20 | 1.33 | n/a | n/a |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood