rs405509 chr19:44905579 T>G
- Sequence
ccccagaatggaggagggtgtctg[T/G]attactgggcgaggtgtcctccct
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | 1.43 | -0.98 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, alzheimers disease, alzheimers disease age of onset of dementia in downs syndrome cases, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), apoa1 (apolipoprotein ai), apob (apolipoprotein b), c-reactive protein (crp), college completion, hdl cholesterol, hdl cholesterol medium lipoprotein fraction concentration, hdl cholesterol medium lipoprotein fraction concentration in fasting sample, late onset alzheimers disease, ldl cholesterol, ldl cholesterol response after 40mg daily simvastatin treatment, ldl cholesterol response to statins, ldl cholesterol response to statins (first post-treatment ldl cholesterol), longevity, neuroblastoma (brain cancer), tetrology of fallot, total cholesterol, triglycerides, vldl cholesterol medium lipoprotein fraction concentration, years of education