rs425105 chr19:46705224 T>C
- Sequence
aaagctctgacccagccccagtcc[T/C]ctatggtaagcacctccttctagt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.49 | 0.71 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, asthma, chronic kidney disease, intracranial aneurysm (male), ldl cholesterol, multiple sclerosis, selective immunoglobulin a deficiency (igad), serum creatinine, total cholesterol, type 1 diabetes
PheWAS abnormal papanicolaou smear of cervix and cervical hpv, abnormal serum enzyme levels, acute bronchitis and bronchiolitis, anomalies of tooth position/malocclusion, arthralgia/ankylosis of temporomandibular joint, benign neoplasm of unspecified sites, breast conditions, congenital or relating to hormones, cardiac shunt/ heart septal defect, cholangitis, choroidal degenerations, congenital anomalies of face and neck, dentofacial anomalies, including malocclusion, diabetes mellitus, diffuse diseases of connective tissue, diseases of sebaceous glands, diseases of the tongue, disorders of choroid, disorders of menstruation, disorders of tooth development, disturbances in tooth eruption, dyshidrosis, effects of radiation nos, femoral hernia, first degree av block, giant cell arteritis, glossitis, hypertrophy of breast (gynecomastia), insect bite, irregular menstrual cycle/bleeding, large cell lymphoma, malaise and fatigue, menopausal & postmenopausal disorders, myeloid leukemia, nonsenile cataract, other sprains and strains, other symptoms referable to back, pancytopenia, pituitary hypofunction, postmenopausal atrophic vaginitis, postmenopausal hormone replacement, primary pulmonary hypertension, renal colic, rotator cuff (capsule) sprain, sebaceous cyst, sicca syndrome, spontaneous ecchymoses, symptomatic menopause, symptoms involving nervous and musculoskeletal systems, type 2 diabetes, urinary complications, ventricular fibrillation & flutter, viral hepatitis c
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood