rs439401 chr19:44911194 T>C
- Sequence
ccaggagccgccggcactctcttc[T/C]cctcccaccccctcagttctcaga
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.99 | -0.17 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.72 | 0.13 | 1.77 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI alzheimers disease, alzheimers disease biomarkers, hdl cholesterol - triglycerides (hdlc-tg), triglyceride levels, triglycerides
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), alzheimers disease, alzheimers disease (age of onset), alzheimers disease (apoe4 positive), apoc4 gene expression in human liver, circulating vitamin e levels (circulating alpha-tocopherol concentrations), cognitive ageing, college completion, hdl cholesterol, hdl cholesterol and triglycerides, hippocampal volume, total cerebral volume, white matter hyperintensities in alzheimers disease patients, late onset alzheimers disease, ldl cholesterol, paternal transmission distortion, plasma adiponectin (females), serum butyrylcholinesterase activity, serum triglycerides levels (males), total cholesterol, transmission distortion, triglycerides, triglycerides (females), triglycerides (ln), triglycerides (males), triglycerides by nmr lipoprotein fraction, triglycerides by nmr lipoprotein fraction in fasting sample, triglycerides lipoprotein fraction, triglycerides lipoprotein fraction in fasting sample, vldl cholesterol large lipoprotein fraction concentration, vldl cholesterol large lipoprotein fraction concentration in fasting sample, vldl cholesterol small lipoprotein fraction concentration in fasting sample, vldl cholesterol total lipoprotein fraction concentration, vldl cholesterol total lipoprotein fraction concentration in fasting sample
PheWAS abnormal findings on mammogram or breast exam, abnormal loss of weight and underweight, acne, acquired hemolytic anemias, acute and chronic tonsillitis, acute pancreatitis, acute pharyngitis, acute upper respiratory infections, alzheimers disease, aphasia/speech disturbance, arthropathy associated with neurological disorders, asthma, asthma with exacerbation, atopic or contact dermatitis, atrophy of edentulous alveolar ridge, bacterial pneumonia, benign neoplasm of uterus, bladder cancer, breast disorder nos, bronchopneumonia and lung abscess, calcium/phosphorus disorders, chronic sinusitis, chronic tonsillitis and adenoiditis, chronic ulcer of skin, contact and allergic dermatitis of eyelid, cyst and pseudocyst of pancreas, delirium dementia and amnestic disorders, dementias, diseases of pancreas, diseases of sebaceous glands, disorders of mineral metabolism, disorders of muscle, ligament, and fascia, disorders of other cranial nerves, disorders of synovium, tendon, and bursa, drug-resistant infection, dupuytrens disease, erectile dysfunction, esophageal bleeding, fasciitis, functional disorders of bladder, heart failure nos, hemorrhage or hematoma complicating a procedure, hyperplasia of prostate, idiopathic fibrosing alveolitis, insomnia, localized superficial swelling, mass, or lump, lower gastrointestinal congenital anomalies, lump or mass in breast, male genital disorders, mental disorders due to brain damage, nerve root lesions, noninflammatory female genital disorders, occlusion of cerebral arteries, with cerebral infarction, oral aphthae, osteoarthrosis, generalized, other abnormal blood chemistry, other alveolar and parietoalveolar pneumonopathy, other conditions of brain, nos, other disorders of urethra and urinary tract, other open wound of head and face, other specified nonpsychotic and/or transient mental disorders, otorrhea, pain in joint, pallor and flushing, paraproteinemia, peritonitis and retroperitoneal infections, persistent mental disorders due to other conditions, personality disorders, pilonidal cyst, pituitary hyperfunction, premature beats, primary thrombocytopenia, pseudomonal pneumonia, rhabdomyolysis, schizophrenia and other psychotic disorders, sleep disorders, spontaneous ecchymoses, stomatitis and mucositis, strabismus (not specified as paralytic), substance addiction and disorders, swelling, mass, or lump in head and neck, symptoms involving head and neck, testicular dysfunction, testicular hypofunction, throat pain, traumatic arthropathy, trigeminal nerve disorders, type 1 diabetic peripheral circulatory disorders, urethral hypermobility/isd, urticaria, uterine leiomyoma, vascular complications of surgery and medical procedures
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Liver, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid