rs465474 chr6:33391365 A>G
- Sequence
caggagaggcagcgctggagcctc[A/G]atcacgtcgacggaaaacaagtgc
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) foreskin keratinocyte epidermal keratinocytes
- ASB for transcription factors
- FOXK2_HUMAN ZN316_HUMAN HDAC1_HUMAN NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.62 | -0.79 | 2.33 | n/a | n/a | |||
| ZN316_HUMAN | 2.05 | n/a | 3.00 | n/a | n/a | |||
| HDAC1_HUMAN | 2.26 | n/a | 3.00 | n/a | n/a | |||
| NCOR1_HUMAN | 2.35 | n/a | 3.00 | n/a | n/a | |||
| NR2C1_HUMAN | 2.13 | 0.44 | 2.44 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GRASP college completion, ldl cholesterol, suicide attempts in bipolar disorder (substance free), total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood