rs4666360 chr2:20135948 G>A
- Sequence
cgggctggggctttgatgcatcag[G/A]cccagagaaagaaacttggtagag
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma) BT-474 (breast invasive ductal carcinoma)
- ASB for transcription factors
- SMC3_HUMAN CTCF_HUMAN ERR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 0.98 | 0.44 | 1.10 | n/a | n/a | |||
| CTCF_HUMAN | 0.61 | 0.47 | 1.28 | n/a | No Hit | |||
| ERR1_HUMAN | 1.54 | 0.14 | 2.40 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), carboplatin-induced neutropenia/leukopenia in cancer patients, cystatin c in serum, fasting blood glucose, hdl cholesterol, hip bone mineral density (bmd), paclitaxel-induced neutropenia/leukopenia in cancer patients, total cholesterol change with statins, waist hip ratio