rs470119 chr22:50528485 T>C
- Sequence
agggtctccatcatcaacctggat[T/C]aatgactgatccgtggcgccccgt
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | n/a | 1.85 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP mean corpuscular hemoglobin (mch), mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), neuroblastoma (brain cancer), red blood cell count (rbc), sporadic creutzfeldt-jakob disease, triglycerides, urinary albumin-to-creatinine ratio, waist hip ratio
PheWAS abnormal findings on radiological breast exam, abnormal thyroid function, acute reaction to stress, althetes foot, aortic aneurysm, arterial embolism and thrombosis of lower extremity artery, atherosclerosis of native arteries of the extremities with intermittent claudication, benign neoplasm of thyroid glands, breast conditions, congenital or relating to hormones, cachexia, candidiasis, cervical radiculitis, chronic kidney disease, stage i or ii, chronic pancreatitis, chronic prostatitis, chronic rheumatic disease of the heart valves, chronic venous insufficiency, conduct disorders, congenital anomalies of intestine, congenital anomalies of urinary system, cyst and pseudocyst of pancreas, cystic kidney disease, degeneration of intervertebral disc, dysmetabolic syndrome x, esophageal atresia/tracheoesophageal fistula, genitourinary congenital anomalies, gross hematuria, hemorrhage of rectum and anus, hypertension complicating pregnancy, hypertensive heart disease, hypertrophy of breast (gynecomastia), incisional hernia, ingrowing nail, iron deficiency anemias, iron deficiency anemias nos, malunion fracture, mechanical complication due to other implant and internal device, methicillin resistant staphylococcus aureus, muscle/tendon sprain, nonrheumatic aortic valve disorders, nonsenile cataract, obstructive chronic bronchitis, open wound of toe(s), osteoarthrosis, generalized, other acute and subacute forms of ischemic heart disease, other aneurysm, other disorders of arteries and arterioles, other peripheral nerve disorders, otorrhea, patellar fracture, pathological, developmental or recurrent dislocation, pelvic peritoneal adhesions, female (postoperative) (postinfection), peripheral autonomic neuropathy, protein-calorie malnutrition, renal dialysis, respiratory complications, supraventricular premature beats, symptoms and disorders of the joints, throat pain, type 2 diabetic ketoacidosis, valvular heart disease/ heart chambers, varicose veins, varicose veins of lower extremity, vitamin b12 deficiency anemia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood