rs4702 chr15:90883330 G>A
- Sequence
ccagcccggctggttttgtaagat[G/A]ctgggttggtgcacagtgattttt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.10 | 0.72 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI age at first sexual intercourse, autism spectrum disorder or schizophrenia, feeling hurt, general risk tolerance (mtag), insomnia, number of sexual partners, schizophrenia
GRASP advanced age-related macular degeneration (geographic atrophy), age at death with kuru exposure, cystatin c in serum, diastolic blood pressure (dbp), height, hip bone mineral density (bmd), resistance to kuru in aged women despite likely exposure, schizophrenia, spine bone mineral density (bmd), systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood