rs476330 chr6:116112102 C>T
- Sequence
gacacatctgtttacccactgttt[C/T]gcccactagagagcgccacctctt
- ASB in cell types
- HepG2 (hepatoblastoma) right lobe of liver pancreas GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.52 | 0.01 | 2.00 | |||
| right lobe of liver | n/a | 1.68 | 1.00 | |||
| pancreas | -0.12 | 1.24 | 1.22 | |||
| GM12878 (female B-cells) | -1.58 | 1.51 | 1.33 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, fasting insulin, hdl cholesterol change with statins, height, infant head circumference, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1), major depressive disorder, serum creatinine, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Spleen, Testis, Thyroid, Whole_Blood