Attention! You are using release Soos. You can switch to the latest ADASTRA version: adastra.autosome.org

rs4925189 chr20:61371988 G>A

Sequence
gtttaatgaggtcacgggcaggcc[G/A]cttgtgtttgtaaacacgtgcaca
ASB in cell types
MCF7 (Invasive ductal breast carcinoma)
ASB for transcription factors
ESR1_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (G) ASB
color scale alt
-log10 FDR of Alt (A) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
ESR1_HUMAN 1.55 -1.26 1.6·10-71.00 2.81 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI cerebrospinal t-tau levels
GRASP cerebrospinal fluid levels of total tau protein (t-tau) (alzheimers disease subjects)
PheWAS abnormal results of function studies acquired absence of breast acute prostatitis adverse effects of opiates and related narcotics in therapeutic use anemia of chronic disease anticoagulants causing adverse effects astigmatism benign neoplasm of bone and articular cartilage benign neoplasm of breast benign neoplasm of other endocrine glands benign neoplasm of unspecified sites bronchitis cerebral edema and compression of brain cervicocranial/cervicobrachial syndrome chorioretinal scars circulatory disease nec disorders of lipoid metabolism disorders of penis disorders of the globe disturbance of salivary secretion duodenal ulcer elevated levels of transaminase or lactic acid dehydrogenase gastritis and duodenitis hemorrhage from gastrointestinal ulcer hx of malignant neoplasm of oral cavity and pharynx hypercholesterolemia hyperlipidemia inflammatory disease of breast injuries to the nervous system lipoid metabolism disorder nos mammographic microcalcification mechanical complications of cardiac/vascular device, implant, and graft memory loss neuralgia, neuritis, and radiculitis nos nontoxic multinodular goiter open wound of lip and mouth other conditions of brain pagets disease of bone peptic ulcer peptic ulcers pericarditis poisoning by agents primarily affecting blood constituents postinflammatory pulmonary fibrosis progressive myopia prostatitis sepsis sinoatrial node dysfunction symptoms involving respiratory system type 2 diabetic peripheral circulatory disorders viral hepatitis

Download