rs499818 chr6:13332235 G>A
- Sequence
ttgcgcctcgttttctagagataa[G/A]gaaatggagatggagtgaggttat
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.56 | 0.62 | 2.97 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cardiovascular disease including myocardial infarction (mi), coronary insufficiency, chd death, atherothrombotic stroke, homa-b, neuroblastoma (brain cancer)
PheWAS abdominal hernia, abnormal results of function study of liver, aneurysm of iliac artery, arteritis nos, atherosclerosis of renal artery, atrial fibrillation, atrial fibrillation & flutter, benign neoplasm of skin, bipolar, calculus of bile duct, calculus of lower urinary tract, cholangitis, choroidal degenerations, chronic kidney disease, stage i or ii, chronic lymphoid leukemia, congenital anomalies of intestine, decreased white blood cell count, deficiency of humoral immunity, dermatomyositis and polymyositis, dermatophytosis of the body, diseases of the oral soft tissues, disorders of choroid, disorders of esophageal motility, disorders of function of stomach, disorders of the autonomic nervous system, dyspepsia and disorders of function of stomach, fracture of lower limb, fracture of tibia and fibula, gastrointestinal complications, immune disorders, jaundice, leukoplakia of oral mucosa, mechanical complication due to other implant and internal device, mood disorders, muscle/tendon sprain, neck pain, nephritis & nephropathy, neutropenia, obstruction of bile duct, osteoarthritis, localized, osteoarthrosis, localized, primary, other biliary tract disease, other conditions of the mother complicating pregnancy, other disorders of gallbladder, other disorders of intestine, other disorders of tympanic membrane, other disorders of urethra and urinary tract, otitis externa, pancreatic cancer, perforation of tympanic membrane, poisoning by other anti-infectives, posttraumatic wound infection, respiratory complications, reticulosarcoma, retinal edema and hypertensive retinopathy, septicemia, severe protein-calorie malnutrition, supraventricular premature beats, symptomatic artificial menopause, symptoms associated with female genital organs, thrombocytopenia, tuberculosis, type 1 diabetes nephropathy, urethritis and urethral syndrome, vertiginous syndromes and other disorders of vestibular system
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood