rs526879 chr3:172035086 A>G
- Sequence
tgggtggggacacagatccaaacc[A/G]tatcacaaactttcagagatgctg
- ASB in cell types
- foreskin keratinocyte bipolar neuron IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.35 | 1.47 | 2.17 | |||
| bipolar neuron | 1.70 | -1.95 | 1.33 | |||
| IPSC-derived bipolar neuron | 1.11 | -0.88 | 1.00 |
Items per page:
1 – 3 of 3