rs542591 chr3:16350401 C>A
- Sequence
tgaaattgctgagtcatggatggg[C/A]gtgggcatttcaaattgttaacag
- ASB in cell types
- coronary artery smooth muscle
- ASB for transcription factors
- JUN_HUMAN NF2L2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.70 | -1.94 | 1.33 | n/a | No Hit | |||
| NF2L2_HUMAN | 1.51 | -1.75 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cognitive response to topiramate treatment, cognitive response to topiramate treatment as measured by the animals cognitive test, cognitive response to topiramate treatment as measured by the controlled oral word association cognitive test, college completion, comorbid depressive syndrome and alcohol dependence, diabetic retinopathy in type 2 diabetes mellitus, prop taste detection threshold
GTEx eQTL Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid