rs544368 chr11:124668099 T>C
- Sequence
cactccttagcaatgacaaacaag[T/C]ctccctgtctttccaacctatctc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.76 | -0.22 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar i disorder), bipolar disorder, bipolar disorder and major depressive disorder, body mass index (bmi), microalbuminuria, premature ovarian failure, schizophrenia, systolic blood pressure (sbp)
PheWAS abnormal findings on examination of urine, abnormal loss of weight and underweight, acute bronchitis and bronchiolitis, acute renal failure, alcoholic liver damage, altered mental status, anemia in chronic kidney disease, anomalies of tooth position/malocclusion, arterial embolism and thrombosis of lower extremity artery, ascites (non malignant), atherosclerosis of native arteries of the extremities with ulceration or gangrene, atherosclerosis of the extremities, av block, back & neck sprains, bacteremia, bacterial infection nos, benign neoplasm of other endocrine glands, cachexia, cancer of mouth, cancer of other female genital organs, cellulitis and abscess of arm, cellulitis and abscess of foot/toes, cerebrovascular disease, chronic ulcer of leg or foot, colles fracture, complication of amputation stump, conduct disorders, deficiency of humoral immunity, dentofacial anomalies, including malocclusion, depression, diaphragmatic hernia, diseases of esophagus, diseases of lips, disorders of cornea, disorders of external ear, disorders of fluid, electrolyte, and acid-base balance, disorders of parathyroid gland, disorders of the autonomic nervous system, dysuria, e. coli, electrolyte imbalance, eosinophilia, esophageal bleeding, esophagitis, gerd and related diseases, fracture of neck of femur, fracture of radius and ulna, fracture of unspecified bones, frequency of urination and polyuria, generalized anxiety disorder, gerd, hearing loss, heart failure, hemiplegia, hepatic cancer, hepatic cancer, primary, history of diseases of digestive system, hypercalcemia, hypercoagulable state, hyperparathyroidism, hyperpotassemia, hypersomnia, hyposmolality and/or hyponatremia, immunity deficiency, impacted cerumen, infection/inflammation of internal prosthetic device, implant or graft, infections involving bone, infections of kidney, iron deficiency anemias, iron deficiency anemias nos, joint/ligament sprain, keratitis, infectious, known or suspected fetal abnormality, late effects of cerebrovascular disease, lung disease due to external agents, malignant neoplasm of brain and nervous system, mechanical complication due to other implant and internal device, miscarriage, stillbirth, mood disorders, nervous system congenital anomalies, neurological disorders due to brain damage, non-healing surgical wound, noninfectious gastroenteritis, nontoxic nodular goiter, open wound of eye or eyelid, open wound of finger(s), open wounds of extremities, open wounds of head, neck, and trunk, osteomyelitis, other disorders of ear, other endocrine disorders, other forms of chronic heart disease, other infectious diseases, other nonspecific findings on examination of urine, other pulmonary inflamation or edema, ovarian cancer, pancreatic cancer, peripheral arterial disease, peripheral autonomic neuropathy, peripheral vascular disease, peritonitis and retroperitoneal infections, persistent mental disorders due to other conditions, personality disorders, phosphorus metabolism disorder, pneumoconiosis, protein-calorie malnutrition, retinal drusen, retinal hemorrhage/ischemia, sarcoidosis, schizophrenia and other psychotic disorders, sciatica, second degree av block, septicemia, subarachnoid hemorrhage (injury), superficial cellulitis and abscess, symptoms involving urinary system, symptoms of the muscles, symptoms/disorders of the urinary system, systolic/diastolic heart failure, tachycardia nos, torsion dystonia, unspecified osteomyelitis, urinary incontinence, urinary tract infection, wheezing