rs575050 chr11:85628498 G>T
- Sequence
ggagggcgcggcttttgactgagt[G/T]ggggcgggcccgggctgcaatcga
- ASB in cell types
- LNCaP (prostate carcinoma) CD14+ monocytes A549 (lung carcinoma)
- ASB for transcription factors
- STAT1_HUMAN E2F1_HUMAN EP300_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.08 | n/a | 2.50 | n/a | No Hit | |||
| E2F1_HUMAN | 1.19 | 0.12 | 1.50 | -1.52 | Weak Concordant | |||
| EP300_HUMAN | 0.25 | 0.85 | 1.30 | n/a | n/a | |||
| JUN_HUMAN | -0.35 | 1.18 | 2.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP 2 hour glucose, college completion, hdl cholesterol, hdl cholesterol change with statins, height, longstanding arthritis, rheumatoid arthritis, stabilized warfarin dose, years of education
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis, Thyroid, Whole_Blood