rs606452 chr11:75565133 A>C
- Sequence
gtatcccaggaacagagactgtcc[A/C]aattggaggccccagagagggaac
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -1.28 | 1.73 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI coronary artery disease, height, hip circumference adjusted for bmi, waist circumference adjusted for bmi (joint analysis main effects and physical activity interaction), waist circumference adjusted for bmi in active individuals, waist circumference adjusted for body mass index
GRASP coronary artery disease (cad), height, height (females), ldl cholesterol, neuroticism, sporadic creutzfeldt-jakob disease
PheWAS abnormal findings on radiological examination intrathoracic organs, abnormal results of function studies, adverse effects of hormones and synthetic substitutes, adverse effects of insulins and antidiabetic agents, adverse effects of sedatives or other central nervous system depressants and anesthetics, angina pectoris, angiodysplasia of intestine, atrial flutter, atrophic gastritis, bacterial infection nos, benign neoplasm of uterus, cardiac and circulatory congenital anomalies, cardiac shunt/ heart septal defect, cellulitis and abscess of foot/toes, cellulitis and abscess of trunk, central/nonobstroctive sleep apnea, cholesteatoma, chronic ischemic heart disease, chronic kidney disease, stage i or ii, chronic venous insufficiency, coronary atherosclerosis, disease of capillaries, disorders of diaphragm, disorders of lipoid metabolism, disorders of refraction and accommodation, elevated blood pressure reading, epistaxis or throat hemorrhage, essential hypertension, fever of unknown origin, fracture of hand or wrist, fracture of vertebral column without mention of spinal cord injury, gangrene, glossitis, heart failure, hereditary and idiopathic peripheral neuropathy, hyperlipidemia, hypertension, hypotension nos, intervertebral disc disorder with myelopathy, ischemic heart disease, lack of coordination, liver replaced by transplant, loose body in joint, menopausal & postmenopausal disorders, multiple sclerosis, myopia, nerve plexus lesions, nerve root and plexus disorders, nevus, non-neoplastic, noninfectious dermatoses of eyelid, noninfectious disorders of lymphatic channels, nonsenile cataract, obesity, open wound of ear, osteochondropathies, overweight, pathologic fracture, phlebitis and thrombophlebitis, pneumonia, postmenopausal bleeding, proteinuria, sacroiliitis nec, seborrhea, secondary hyperparathyroidism (of renal origin), sepsis, sepsis and sirs, stress incontinence, female, superficial cellulitis and abscess, symptomatic menopause, type 1 diabetes nephropathy, ulceration of intestine, varicose veins, varicose veins of lower extremity, varicose veins of lower extremity, symptomtic