rs6096573 chr20:51767140 C>T
- Sequence
acccttatggttcactccacccgc[C/T]gcgtctcctgttccgagcaactga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
- ASB for transcription factors
- PRD10_HUMAN MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRD10_HUMAN | n/a | 2.37 | 2.00 | n/a | n/a | |||
| MNT_HUMAN | -0.32 | 1.97 | 2.22 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting blood glucose, homa-b, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), lung function, forced vital capacity (fvc) (fev1/fvc) percent predicted (in asthmatic participants), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) (in asthmatic participants), obesity with early age of onset (age >2), rheumatoid arthritis, salmonella-induced pyroptosis, total cholesterol change with statins
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood