Attention! You are using release Soos. You can switch to the latest ADASTRA version: adastra.autosome.org

rs610604 chr6:137878280 G>T

Sequence
cagatcatgttgcgtgaaaagtgt[G/T]agctcttcatcacaggcctgcatt
ASB in cell types
CD14+ monocytes
ASB for transcription factors
STAT1_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (G) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
STAT1_HUMAN n/a 2.62 1.007.3·10-4 2.50 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI cutaneous psoriasis psoriasis psoriasis vulgaris
GRASP arthritis including non-rheumatoid hip bone mineral density (bmd) ldl cholesterol neuroblastoma (brain cancer) psoriasis psoriasis (cutaneous psoriasis) psoriatic arthritis rheumatoid arthritis spine bone mineral density (bmd) total cholesterol
PheWAS abnormal coagulation profile abnormal findings on study of brain, nervous system abnormal papanicolaou smear of cervix and cervical hpv acute, but ill-defined cerebrovascular disease alkalosis anemia in neoplastic disease ankylosis of joint anomalies of tooth position/malocclusion atherosclerosis attention deficit hyperactivity disorder biliary cirrhosis blister bronchitis bronchopneumonia and lung abscess cancer of oropharynx carbohydrate transport and metabolism disorder cholelithiasis and cholecystitis chronic airway obstruction chronic osteomyelitis chronic prostatitis coagulation defects complication of internal orthopedic device conductive hearing loss congenital musculoskeletal deformities of spine deficiency anemias nos disaccharide malabsorption diseases of spleen disorders of fluid, electrolyte, and acid-base balance disturbances of sensation of smell and taste diverticulitis diverticulosis and diverticulitis elevated prostate specific antigen first degree av block fracture of upper limb genu valgum or varum (acquired) heart failure hemorrhage of gastrointestinal tract hemorrhagic disorder due to intrinsic circulating anticoagulants herpes simplex hyperglyceridemia hypertension complicating pregnancy hypovolemia ill-defined descriptions and complications of heart disease infection/inflammation of internal prosthetic device, implant or graft inflammatory conditions of jaw intestinal obstruction without mention of hernia intracranial hemorrhage iron deficiency anemia secondary to blood loss keratoderma, acquired lung disease due to external agents lyme disease memory loss neurological disorders due to brain damage non-healing surgical wound noninfectious gastroenteritis nonrheumatic aortic valve disorders optic atrophy orthostatic hypotension osteitis deformans and osteopathies associated with other disorders other abnormality of urination other benign neoplasm of connective and other soft tissue other intestinal obstruction other specified disorders of breast otitis media paralytic ileus photodermatitis & sunburn pneumonitis due to inhalation of food or vomitus prostate cancer pseudomonal pneumonia pulmonary collapse interstitial/compensatory emphysema raynauds syndrome reflux esophagitis retention of urine seborrhea secondary malignant neoplasm of liver sleep disorders spirochetal infection stricture/obstruction of ureter suppurative and unspecified otitis media symptoms involving cardiovascular system symptoms/disorders of the urinary system syncope and collapse systolic/diastolic heart failure torticollis toxic erythema type 2 diabetic peripheral circulatory disorders unspecified local infection of skin and subcutaneous tissue urinary obstruction

Download