rs644827 chr6:31870664 T>C
- Sequence
tccgctgccgcaggaagatgagca[T/C]cagcagcaggatggcttcaagcac
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.02 | 1.52 | 2.25 | |||
| K562 (myelogenous leukemia) | 0.68 | -0.34 | 3.29 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alopecia areata, aortic valve calcium, body mass index (bmi), coronary artery disease (cad), fasting insulin, height, homa-b, homa-ir, idiopathic membranous nephropathy, infant head circumference, irritible bowel syndrome, late onset alzheimers disease, ldl cholesterol, multiple sclerosis, nonalcoholic fatty liver disease (aspartate aminotransferase (ast)), rheumatoid arthritis, salmonella-induced pyroptosis, sarcoidosis, systolic blood pressure (sbp), tetrology of fallot, total cholesterol, triglycerides, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Vagina, Whole_Blood