rs652889 chr3:61808380 C>A
- Sequence
cagaaacccctggtgaactttgta[C/A]gtggcactcacccctattccttaa
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.69 | 0.15 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
PheWAS abdominal pain, abnormal electrocardiogram, acidosis, allergies, other, althetes foot, arthropathy associated with neurological disorders, arthropathy associated with other disorders classified elsewhere, atrial fibrillation, atrial fibrillation & flutter, bullous dermatoses, calculus of kidney, cardiac arrest & ventricular fibrillation, cardiac arrhythmia nos, cardiac conduction disorders, cardiac dysrhythmias, cataract, cellulitis and abscess of arm, cerebral edema and compression of brain, cholecystitis without cholelithiasis, corneal edema, disorders of cervical region, disorders of optic nerve and visual pathways, disorders of sweat glands, disturbances in tooth eruption, dyshidrosis, dysuria, e. coli, empyema and pneumothorax, epilepsy, gout, gout and other crystal arthropathies, hallux valgus (bunion), hemorrhage or hematoma complicating a procedure, hypertension complicating pregnancy, hyperventilation, hypotension, iatrogenic hypotension, infertility, female, keratoconjunctivitis, noninfectious, lymphosarcoma, optic neuritis/neuropathy, osteoarthrosis, localized, secondary, other aneurysm, other conditions of brain, other disorders of circulatory system, other disorders of metabolic, endocrine, immunity disorders, other disorders of metabolism, other rheumatic heart disease, other specified cardiac dysrhythmias, palpitations, paralysis/spasm of vocal cords or larynx, parasomnia, partial epilepsy, polyneuropathy in diabetes, posterior pituitary disorders, progressive myopia, psoriatic arthropathy, pyogenic granuloma, renal colic, renal osteodystrophy, sicca syndrome, stress fracture, symptoms involving cardiovascular system, thrombocytopenia, ventricular fibrillation & flutter