rs653178 chr12:111569952 C>T
- Sequence
atgatgaagatgtcctatgtcatg[C/T]tgtccaatattgcagccattaggc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.39 | 0.56 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI alopecia areata, blood pressure, celiac disease, celiac disease or rheumatoid arthritis, chronic kidney disease, crohns disease, diastolic blood pressure, eczema, eosinophil counts, eosinophil percentage of granulocytes, eosinophil percentage of white cells, inflammatory bowel disease, ldl cholesterol, mean arterial pressure, monocyte count, myocardial infarction, neutrophil percentage of granulocytes, peripheral artery disease, sarcoidosis, sum eosinophil basophil counts, systemic lupus erythematosus, thyroid peroxidase antibody levels, thyroid peroxidase antibody positivity, tonsillectomy, total cholesterol levels, type 1 diabetes, urate levels
GRASP aldh2 expression, aldh2 gene expression in blood, attention-deficit/hyperactivity disorder (adhd), blood eosinophil count, body mass index (bmi), celiac disease, coronary artery disease (cad), cystatin c in serum, diastolic blood pressure (dbp), diastolic blood pressure (dbp) (female), diastolic blood pressure (dbp) (male), drug-induced liver injury-all dili cases presenting with any of three recorded extrahepatic immuno-allergic features (eosinophilia, fever, and/or rash), drug-induced liver injury-all dili cases presenting with fever, erythrocyte count, essential hypertension, hdl cholesterol, hematocrit (hct), hemoglobin (hb), hypertension, hypothyroidism, irritible bowel syndrome, ldl cholesterol, mean arterial pressure, multiple sclerosis, myocardial infarction (mi), plasma beta-2 microglobulin levels, platelet count (plt), primary biliary cirrhosis, primary biliary cirrhosis (antimitochondrial-antibody positive only), red blood cell count (rbc), refractive error, rheumatoid arthritis, rheumatoid arthritis and celiac disease, selective immunoglobulin a deficiency (igad), serum creatinine, serum creatinine estimated glomerular filtration rate (egfr), serum creatinine estimated glomerular filtration rate (egfr) (no diabetes), serum creatinine estimated glomerular filtration rate (egfr) (with diabetes), serum cystatin c estimated glomerular filtration rate (egfr), serum urate, sh2b3 expression, sh2b3/ atxn2 gene expression in blood, soluble intercellular adhesion molecule 1 (icam-1), systolic blood pressure (sbp), systolic blood pressure (sbp) and diastolic blood pressure (dbp), tetrology of fallot, tmem116 expression, total cholesterol, years of education
PheWAS abdominal aortic aneurysm, abnormal findings on mammogram or breast exam, abnormal findings on radiological breast exam, acquired absence of breast, acquired hemolytic anemias, acute bronchospasm, anal and rectal polyp, anomalies of tooth position/malocclusion, aortic aneurysm, aphasia/speech disturbance, arterial embolism and thrombosis, arterial embolism and thrombosis of lower extremity artery, arthropathy associated with infections, astigmatism, atherosclerosis, atherosclerosis of native arteries of the extremities with intermittent claudication, atherosclerosis of native arteries of the extremities with ulceration or gangrene, atherosclerosis of renal artery, atherosclerosis of the extremities, behcets syndrome, benign neoplasm of colon, benign neoplasm of uterus, cachexia, cancer of larynx, cancer of the upper aerodigestive tract, cardiac arrhythmia nos, cardiac shunt/ heart septal defect, chronic ischemic heart disease, congenital anomalies of lower limb, including pelvic girdle, constipation, corneal edema, coronary atherosclerosis, cysts of the jaws, dentofacial anomalies, including malocclusion, disease of tricuspid valve, disorders of refraction and accommodation, empyema and pneumothorax, endometriosis, essential hypertension, fracture of vertebral column without mention of spinal cord injury, gout and other crystal arthropathies, hemiplegia, hirsutism, hyperlipidemia, hypermetropia, hypertension, hypothyroidism, iatrogenic hypotension, impaired fasting glucose, inflammatory and toxic neuropathy, iron deficiency anemias, ischemic heart disease, labyrinthitis, lack of coordination, mastodynia, mechanical complications of cardiac/vascular device, implant, and graft, menieres disease, menopausal & postmenopausal disorders, migraine, mitral stenosis/insufficiency, morbid obesity, myocardial infarction, open wound of finger(s), open wounds of extremities, open wounds of head, neck, and trunk, open-angle glaucoma, osteoporosis, osteoporosis, nos or other, other aneurysm, other biliary tract disease, other congenital anomalies of skin, other diseases of lung, other disorders of biliary tract, other disorders of gallbladder, other forms of chronic heart disease, other rheumatic heart disease, ovarian dysfunction, pancreatic cancer, paranoid disorders, peripheral arterial disease, peripheral vascular disease, peyronies disease, phlebitis and thrombophlebitis of lower extremities, polycystic ovaries, posterior pituitary disorders, primary open angle glaucoma, psoriasis, psoriasis vulgaris, purpura and other hemorrhagic conditions, retinoschisis and retinal cysts, somatoform disorder, uterine leiomyoma, ventricular fibrillation & flutter
Finemapping celiac disease, chronic kidney disease, juvenile idiopathic arthritis, primary sclerosing cholangitis, urate levels
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Colon_Sigmoid, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg