rs660240 chr1:109275216 T>C
- Sequence
tttgttttatttatttgctttttg[T/C]gttgggatgggttcgtgtccagtc
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | -1.88 | 1.95 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI cardiovascular disease risk factors, heel bone mineral density, high density lipoprotein cholesterol levels, ldl cholesterol, low density lipoprotein cholesterol levels, progranulin levels, total cholesterol levels
GRASP advanced age-related macular degeneration (geographic atrophy), bipolar disorder, coronary artery disease (cad), gene expression of psrc1 in blood, hdl cholesterol, height, ldl cholesterol, ldl cholesterol change with statins, ldl cholesterol in serum, lp-pla2 activity, prop taste detection threshold, total cholesterol, total cholesterol change with statins, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood