rs6648 chr20:49278705 A>G
- Sequence
agttgcagtcaggcttcatacgct[A/G]ttgtcctgcccgtaagttcccgtt
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) HEK293T (embryonic kidney)
- ASB for transcription factors
- STAT1_HUMAN FOXK2_HUMAN ZFX_HUMAN OSR2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.11 | n/a | 2.50 | n/a | No Hit | |||
| FOXK2_HUMAN | 2.01 | 0.09 | 1.58 | n/a | n/a | |||
| ZFX_HUMAN | 1.43 | -1.92 | 2.00 | n/a | No Hit | |||
| OSR2_HUMAN | n/a | 2.36 | 2.00 | n/a | No Hit | |||
| E4F1_HUMAN | 1.88 | -0.68 | 1.50 | n/a | n/a |
Items per page:
1 – 5 of 10
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, fasting insulin, height, homa-ir, infant head circumference, obesity with early age of onset (age >2), triglycerides change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Testis, Thyroid, Whole_Blood