rs675209 chr6:7101851 T>C
- Sequence
atcttggccctgatttctgcacct[T/C]accccccatccctcgttccccctc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.56 | -0.61 | 2.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP coronary heart disease (chd), cystatin c in serum, gout, loggfr creatinine, serum urate, uric acid (males) in serum, uric acid in serum, waist hip ratio
PheWAS abnormal movement, abnormal papanicolaou smear of cervix and cervical hpv, abnormal thyroid function, abnormality of gait, aplastic anemia, arterial embolism and thrombosis, aseptic necrosis of bone, cellulitis and abscess of leg, cervical cancer and dysplasia, cervical intraepithelial neoplasia (cervical dysplasia), cholecystitis without cholelithiasis, complication of internal orthopedic device, congenital anomalies of limbs, congenital deformities of feet, disorders of coccyx, diverticulitis, diverticulosis and diverticulitis, drug-resistant infection, empyema and pneumothorax, endometriosis, epistaxis or throat hemorrhage, esophageal atresia/tracheoesophageal fistula, gastrointestinal malfunction arising from mental factors, generalized anxiety disorder, hereditary hemolytic anemias, hypothyroidism, hypovolemia, idiopathic fibrosing alveolitis, impetigo, infestation, insomnia, lesions of stomach and duodenum, nervous system congenital anomalies, nontoxic multinodular goiter, nontoxic nodular goiter, nontoxic uninodular goiter, open wound of nose and sinus, open wounds of extremities, optic atrophy, otalgia, other alveolar and parietoalveolar pneumonopathy, other disorders of thyroid, other hypertrophic and atrophic conditions of skin, peyronies disease, poisoning by analgesics, antipyretics, and antirheumatics, polycythemia vera, secondary, pulmonary embolism and infarction, sacroiliitis nec, secondary malignancy of bone, somatoform disorder, type 1 diabetic peripheral circulatory disorders, type 2 diabetic ketoacidosis, unspecified monoarthritis