rs6859 chr19:44878777 A>G
- Sequence
ttgggacttggagggaggtggaac[A/G]gcacactggacttctcccgtctct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GRHL2_HUMAN | 1.24 | -0.18 | 1.94 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI alzheimers disease, alzheimers disease (late onset), alzheimers disease or family history of alzheimers disease, family history of alzheimers disease
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alzheimers disease, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), apoa1 (apolipoprotein ai), apob (apolipoprotein b), body mass index (bmi), cognitive ageing (females), cystatin c in serum, hdl cholesterol, late onset alzheimers disease, ldl cholesterol, ldl cholesterol (female), ldl cholesterol (male), obesity with early age of onset (age >2), total cholesterol, triglycerides
PheWAS abnormal findings on radiological exam of musculoskeletal system, abnormal reflex, abnormal weight gain, adverse effects of opiates and related narcotics in therapeutic use, age-related macular degeneration, alcohol-related disorders, alcoholism, alzheimers disease, aseptic necrosis of bone, atherosclerosis of renal artery, breast disorder nos, bursitis, cardiac and circulatory congenital anomalies, cardiac congenital anomalies, cardiac shunt/ heart septal defect, cholecystitis without cholelithiasis, chronic renal failure, congenital anomalies of urinary system, cystic kidney disease, delirium dementia and amnestic disorders, dementias, develomental delays and disorders, deviated nasal septum, diabetic retinopathy, dislocation, disorders of lipoid metabolism, dyspepsia and disorders of function of stomach, fracture of humerus, genitourinary congenital anomalies, hemorrhoids, hydronephrosis, hypercholesterolemia, hyperlipidemia, inflammatory bowel disease, jaw disease nos, known or suspected fetal abnormality, lesions of stomach and duodenum, liver replaced by transplant, macular degeneration, dry, mechanical complication due to other implant and internal device, memory loss, mitral valve stenosis and/or aortic valve stenosis, mood disorders, morbid obesity, nephritis and nephropathy in diseases classified elsewhere, nephritis, nephrosis, renal sclerosis, neurological disorders due to brain damage, nontoxic multinodular goiter, nontoxic nodular goiter, nontoxic uninodular goiter, open-angle glaucoma, other disorders of peritoneum, other symptoms involving abdomen and pelvis, pain, swelling or discharge of eye, paralytic ileus, peritoneal adhesions (postoperative) (postinfection), pervasive developmental disorders, pneumonitis due to inhalation of food or vomitus, primary open angle glaucoma, reticulosarcoma, retinal hemorrhage/ischemia, senile dementia, supraventricular premature beats, symptoms associated with female genital organs, temporomandibular joint disorder nos, ulcerative colitis, unequal leg length (acquired), viral infection
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Esophagus_Muscularis, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood