rs712039 chr17:37490447 C>T
- Sequence
caagtgtccaacttgagtctttct[C/T]tgcggtggtagatgggtgtgcgcg
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.64 | 0.39 | 1.32 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, blood pressure response to candesartan treatment, eye color, hypertension (early onset hypertension), late onset alzheimers disease, tuberculosis
PheWAS abnormal findings on mammogram or breast exam, abnormal involuntary movements, abnormal results of function studies, abnormal thyroid function, adverse drug events and drug allergies, adverse effects of antineoplastic and immunosuppressive drugs, adverse effects of opiates and related narcotics in therapeutic use, adverse effects of sedatives or other central nervous system depressants and anesthetics, age-related macular degeneration, arthropathy nos, atherosclerosis of aorta, bacterial enteritis, bacterial pneumonia, cerebral aneurysm, cervical cancer, cholelithiasis with other cholecystitis, chronic obstructive asthma, cns infection and poliomyelitis, cyst or abscess of bartholins gland, ectropion or entropion, edema, epilepsy, essential tremor, fracture of upper limb, ileostomy status, inflammation of eyelids, inflammation of the eye, inflammatory conditions of jaw, intestinal infection due to c. difficile, jaw disease nos, joint/ligament sprain, keratitis, malignant neoplasm of ovary, mechanical complication due to other implant and internal device, mental disorders due to brain damage, migraine, miscarriage, stillbirth, non-melanoma skin cancer, nontoxic uninodular goiter, open wound of nose and sinus, oral aphthae, osteitis deformans and osteopathies associated with other disorders, other disorders of back, other disorders of eyelids, other disorders of intestine, other specified nonpsychotic and/or transient mental disorders, other specified peripheral vascular diseases, otitis media, paralytic ileus, paroxysmal tachycardia, unspecified, paroxysmal ventricular tachycardia, partial epilepsy, personal history of allergy to medicinal agents, poisoning by primarily systemic agents, ptosis of eyelid, retinal detachments and defects, retinal vascular changes and abnomalities, secondary malignant neoplasm of digestive systems, severe protein-calorie malnutrition, shock, strabismus (not specified as paralytic), subarachnoid hemorrhage, type 1 diabetic ketoacidosis, ulcer of esophagus, ulceration of the lower gi tract, urethral stricture (not specified as infectious), vascular insufficiency of intestine
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood