rs712958 chr22:19179896 T>C
- Sequence
cccactacacgcggaagttgtaca[T/C]tggaggctggcgaagttgggagca
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- MNT_HUMAN ZN335_HUMAN FOXK2_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 1.91 | n/a | 4.00 | n/a | n/a | |||
| ZN335_HUMAN | 1.98 | -2.27 | 1.50 | n/a | No Hit | |||
| FOXK2_HUMAN | 1.15 | -1.18 | 3.11 | n/a | n/a | |||
| HDAC1_HUMAN | 1.79 | -0.31 | 4.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in asthmatic participants), triglycerides change with statins
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood