rs717615 chr4:10103046 A>G
- Sequence
tgtgtacaggaaaagctctgcgtc[A/G]aagaactaagtaaataaaaaaaca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | 1.67 | -1.19 | 1.78 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, microalbuminuria, personality disorders (pd) - cluster c, rheumatoid arthritis, serum urate, uric acid, uric acid (females) in serum, uric acid in serum
PheWAS abnormal findings on radiological exam of musculoskeletal system, bacterial infection nos, cancer, suspected or other, cardiac defibrillator in situ, crohns disease, cystic kidney disease, decreased white blood cell count, dentofacial anomalies, including malocclusion, diseases of nail, disorders of the globe, duodenal ulcer, e. coli, early or threatened labor, hemorrhage in early pregnancy, endometriosis, fracture of pelvis, glomerulonephritis, gout, gout and other crystal arthropathies, h. pylori, hemorrhage in early pregnancy, hepatic cancer, hereditary and idiopathic peripheral neuropathy, herpes zoster, hyperventilation, hypoglycemia, infections of kidney, inflammatory bowel disease, malignant neoplasm, other, mechanical complication due to other implant and internal device, muscular dystrophies and other myopathies, neutropenia, other acquired musculoskeletal deformity, other diseases of the teeth and supporting structures, other disorders of metabolic, endocrine, immunity disorders, other intestinal obstruction, pelvic inflammatory disease, progressive myopia, prostate cancer, prurigo, pulmonary collapse, interstitial/compensatory emphysema, secondary malignancy of bone, secondary malignant neoplasm, somatoform disorder, symptoms involving respiratory system, testicular dysfunction, unspecified local infection of skin and subcutaneous tissue, ventricular fibrillation & flutter, viral warts & hpv
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid