rs727428 chr17:7634474 T>C
- Sequence
aggaggaagggaagagatgggatt[T/C]tgacatctcagtcatctggtcctt
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma) CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.56 | 0.86 | 1.63 | n/a | No Hit | |||
| RAD21_HUMAN | -0.44 | 0.76 | 2.41 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, age at menarche, body mass index (bmi), circulating sex hormone-binding globulin levels, circulating sex hormone-binding globulin levels in non-postmenopausal hormone users, circulating sex hormone-binding globulin levels in postmenopausal hormone users, hdl cholesterol, ldl cholesterol, serum dihydrotestosterone (dht) level, serum dihydrotestosterone level in dutasteride or placebo treatment group, serum dihydrotestosterone level in dutasteride treatment group, serum dihydrotestosterone level in placebo group, serum testosterone (t) level in dutasteride or placebo treatment group, serum testosterone (t) level in dutasteride treatment group, serum testosterone (t) level in placebo group, waist hip ratio
GTEx eQTL Artery_Tibial, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood