rs738322 chr22:38172999 A>G
- Sequence
ctgggacacaggccgactgtgggc[A/G]cacaaacagtggccattgttatca
- ASB in cell types
- HEK293 (embryonic kidney) liver
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.74 | -0.33 | 1.95 | |||
| liver | 0.04 | 0.92 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, autism, autism with low iq, autism with verbal ability, birth weight, body mass index (bmi), breast cancer, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, hdl cholesterol change with statins, height, hip bone mineral density (bmd), infant head circumference, ldl cholesterol, longstanding arthritis, melanocytic nevus count, melanoma (skin cancer), myopia, nevus count, parkinsons disease, serum creatinine, total cholesterol, triglycerides
PheWAS abnormal findings on radiological breast exam, abnormal mammogram, acute prostatitis, aneurysm of iliac artery, angiodysplasia of intestine, anxiety, phobic and dissociative disorders, arthropathy nos, benign neoplasm of eye, benign neoplasm of ovary, benign neoplasm of uterus, calculus of bile duct, cellulitis and abscess of hand/fingers, cellulitis and abscess of trunk, cerebral edema and compression of brain, cholecystitis without cholelithiasis, cholelithiasis, cholelithiasis and cholecystitis, cholelithiasis with other cholecystitis, chronic hepatitis, chronic sinusitis, congenital pigmentary anomalies of skin, curvature of spine, cystoid macular degeneration of retina, diseases of the oral soft tissues, disorders of coccyx, dupuytrens disease, empyema and pneumothorax, excessive or frequent menstruation, infections involving bone, inflammatory diseases of prostate, macular degeneration, wet, magnesium metabolism disorder, male genital disorders, open wound of foot except toe(s) alone, orchitis and epididymitis, osteomyelitis, other arthropathies, other disorders of arteries and arterioles, other disorders of gallbladder, other hereditary hemolytic anemias, pathological, developmental or recurrent dislocation, pneumonitis due to inhalation of food or vomitus, pruritus and related conditions, psychogenic disorder, reflux esophagitis, skin neoplasm of uncertain behavior, stress incontinence, female, subjective visual disturbances, superficial cellulitis and abscess, type 2 diabetic ketoacidosis, ulceration of intestine, ulceration of the lower gi tract, unspecified osteomyelitis, urinary incontinence, vitamin b12 deficiency anemia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood