rs764828 chr2:100292172 A>C
- Sequence
tcattcatagcatggtgaaactgg[A/C]ggcgccctgaagattcctcttcaa
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- ESR1_HUMAN GATA1_HUMAN CREB1_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.15 | 0.86 | 1.55 | n/a | No Hit | |||
| GATA1_HUMAN | 0.34 | 1.86 | 1.88 | n/a | No Hit | |||
| CREB1_HUMAN | -1.13 | 1.58 | 1.33 | n/a | No Hit | |||
| JUN_HUMAN | -0.23 | 1.34 | 2.14 | n/a | No Hit | |||
| EP300_HUMAN | -0.24 | 1.33 | 1.96 | n/a | n/a |
Items per page:
1 – 5 of 10
Motif analysis
No data available
Genetic associations
GRASP college completion, eye color, hdl cholesterol change with statins, height, parkinsons disease, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Adrenal_Gland, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid