rs774359 chr9:27561051 T>C
- Sequence
cttactcaatgcttataacaaccc[T/C]acacattaggtactattactatta
- ASB in cell types
- LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.01 | 1.36 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), amyotrophic lateral sclerosis (als) with >2 c9orf72 hexanucleotide repeats, amyotrophic lateral sclerosis (als) with c9orf72 hexanucleotide repeat mutations, amyotrophic lateral sclerosis (als) with n=7-23 c9orf72 hexanucleotide repeats, fasting blood glucose, frontotemporal lobar degeneration with tdp-43 inclusions (grn mutation negative), number of c9orf72 hexanucleotide repeats in amyotrophic lateral sclerosis (als) patients, response to anti-tnf therapy in patients with rheumatoid arthritis (good response vs. no response), response to anti-tnf therapy in patients with rheumatoid arthritis (relative change in 28-joint count disease activity score), response to anti-tnf treatment for rheumatoid arthritis (change in disease activity score (das28)), sporadic amyotrophic lateral sclerosis (als)
PheWAS abnormal papanicolaou smear of cervix and cervical hpv, acute and chronic tonsillitis, aneurysm and dissection of heart, anomalies of tooth position/malocclusion, arterial embolism and thrombosis, arterial embolism and thrombosis of lower extremity artery, aseptic necrosis of bone, atherosclerosis of the extremities, atrial fibrillation, atrial fibrillation & flutter, atrial flutter, attention deficit hyperactivity disorder, benign neoplasm of thyroid glands, blood vessel replaced, bronchopneumonia and lung abscess, cardiac pacemaker in situ, cardiac pacemaker/device in situ, cardiomegaly, cardiomyopathy, central/nonobstroctive sleep apnea, chronic bronchitis, chronic interstitial cystitis, chronic venous insufficiency, concussion, dentofacial anomalies, including malocclusion, disorders of menstruation, disorders of sacrum, disturbances of sensation of smell and taste, diverticulum of esophagus, acquired, duodenal ulcer, dysmenorrhea, dyspareunia, dysthymic disorder, effects of radiation nos, femoral hernia, gastrointestinal complications, generalized anxiety disorder, gestational diabetes, hallux rigidus, hemorrhage from gastrointestinal ulcer, hypercoagulable state, impacted cerumen, infections of kidney, inflammatory and toxic neuropathy, inflammatory spondylopathies, kyphosis (acquired), lump or mass in breast, macular degeneration, wet, mastoiditis, menopausal & postmenopausal disorders, muscular dystrophies and other myopathies, other cardiac conduction disorders, other conditions of brain, other disorders of back, other symptoms referable to back, otitis externa, peripheral autonomic neuropathy, personal history of allergy to medicinal agents, peyronies disease, pilonidal cyst, poisoning by agents primarily affecting blood constituents, postmenopausal atrophic vaginitis, primary/intrinsic cardiomyopathies, proteinuria, rheumatoid arthritis, rheumatoid arthritis & related inflammatory polyarthropathies, sexually transmitted infections, stricture and stenosis of esophagus, swelling of limb, symptomatic artificial menopause, symptomatic menopause, thyroid cancer, unstable angina (intermediate coronary syndrome)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood