rs7773004 chr6:26267527 A>G
- Sequence
actaagaacctgtgtgaggtggga[A/G]ttgaagggaaaattattctgccct
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.65 | 0.43 | 2.97 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI varicose veins, waist circumference adjusted for bmi (adjusted for smoking behaviour), waist circumference adjusted for bmi (joint analysis main effects and smoking interaction), waist circumference adjusted for bmi in non-smokers, waist circumference adjusted for body mass index
GRASP alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), height, hemoglobin (hb), mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), obesity with early age of onset (age >2), prop taste detection threshold, rheumatoid arthritis, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood