rs8040868 chr15:78618839 T>C
- Sequence
gatgactgggtcagacacgttggc[T/C]acaggccggatgatctcattgtaa
- ASB in cell types
- HEK293 (embryonic kidney) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | -0.13 | 1.75 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI familial lung cancer, lung function (fev1/fvc), obesity-related traits, post bronchodilator fev1, post bronchodilator fev1/fvc ratio, post bronchodilator fev1/fvc ratio in copd, pre bronchodilator fev1, pre bronchodilator fev1/fvc ratio, pulmonary function (smoking interaction), smoking behaviour (cigarettes smoked per day), squamous cell lung carcinoma
GRASP lung function, forced expiratory volume in 1 second (fev1), lung function, forced expiratory volume in 1 second (fev1) smoking pack years, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), smoking pack years, nicotine dependence (smoking), cigarettes per day, sleep energy expenditure adj weight (kcal/d) in children, transmission distortion, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood