rs8100241 chr19:17282085 G>A
- Sequence
gtagaggagctgctgcgctgcggc[G/A]cggaccctaatttggtgctagagg
- ASB in cell types
- HCT-116 (colon carcinoma) K562 (myelogenous leukemia)
- ASB for transcription factors
- ZFX_HUMAN MGAP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -2.44 | 2.34 | 1.00 | n/a | No Hit | |||
| MGAP_HUMAN | 2.79 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), birth weight, breast cancer (brca1-carriers), breast cancer (estrogen receptor negative breast cancer), breast cancer risk (brca1 class 1 mutations only), breast cancer risk (brca1 class 2 mutations only), breast cancer risk (brca1 estrogen receptor status), breast cancer risk (brca1 estrogen receptor/progesterone receptor status), breast cancer risk (brca1 progesterone receptor status), breast cancer risk (excluding brca1 mutation carriers who developed ovarian cancer), breast cancer risk (excluding breast cancer cases diagnosed with breast cancer more than 5 years prior to study recruitment), breast cancer risk (in brca1 mutation carriers), breast cancer risk (triple negative breast cancer)
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood