rs828883 chr2:74148330 G>A
- Sequence
tggcagtctagcttctaagctgag[G/A]agtttggccttcgctccaggtgcg
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.04 | -0.15 | 1.98 | |||
| HepG2 (hepatoblastoma) | -0.21 | 0.72 | 1.97 | |||
| HEK293 (embryonic kidney) | 0.53 | 0.55 | 1.31 | |||
| GM12878 (female B-cells) | 0.64 | 0.28 | 1.30 | |||
| HEK293T (embryonic kidney) | -0.18 | 0.84 | 2.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, birth weight, hdl cholesterol change with statins, homa-b, major depressive disorder, neuroticism, refractive error, response to anti-tumor necrosis factor treatment of rheumatoid arthritis, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood