rs837763 chr16:88787321 C>T
- Sequence
agaagcttgtcaaataaatgatag[C/T]gtgtctcacagtggagtgctacac
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.36 | 0.56 | 2.42 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI glycated hemoglobin levels, mean corpuscular hemoglobin concentration, mean corpuscular volume, red blood cell count
GRASP arthritis including non-rheumatoid, hemoglobin (hb), infant head circumference, ldl cholesterol, mean corpuscular hemoglobin concentration (mchc), red blood cell count (rbc), refractive error, total cholesterol
PheWAS abdominal aortic aneurysm, abnormal findings on examination of urine, abnormal involuntary movements, abnormal kidney function, abnormal movement, abnormal reflex, acquired toe deformities, adrenal hypofunction, age-related macular degeneration, altered mental status, amblyopia, aneurysm of iliac artery, aneurysm of other specified artery, ankylosing spondylitis, appendiceal conditions, appendicitis, astigmatism, atherosclerosis of native arteries of the extremities with ulceration or gangrene, atrophy of edentulous alveolar ridge, benign neoplasm of brain and other parts of nervous system, blindness and low vision, blister, carditis, cervicocranial/cervicobrachial syndrome, chronic lymphoid leukemia, chronic venous insufficiency, colles fracture, complex regional/central pain syndrome, congenital anomalies of face and neck, congenital anomalies of intestine, congenital anomalies of urinary system, congenital musculoskeletal deformities of spine, corneal dystrophy, corneal edema, cystoid macular degeneration of retina, diaphragmatic hernia, diseases of blood and blood-forming organs, disorders of conjunctiva, disorders of cornea, disorders of external ear, disorders of refraction and accommodation, diverticulitis, elevated levels of transaminase or lactic acid dehydrogenase, end stage renal disease, fracture of pelvis, fuchs dystrophy, functional digestive disorders, gross hematuria, heart valve disorders, heart valve replaced, hemorrhage of gastrointestinal tract, hypermetropia, irregular menstrual cycle, jaundice, keratoconjunctivitis, noninfectious, keratoderma, acquired, kidney replaced by transpant, lack of coordination, leukemia, lymphoid leukemia, macular degeneration, macular degeneration, dry, macular degeneration, wet, male infertility and abnormal spermatozoa, microscopic hematuria, myopia, osteoporosis, nos or other, other aneurysm, other cardiac conduction disorders, other hypertrophic and atrophic conditions of skin, other symptoms referable to back, pallor and flushing, phosphorus metabolism disorder, pleurisy, pleural effusion, progressive myopia, prurigo, pulmonary embolism and infarction, rash and other nonspecific skin eruption, retinal detachments and defects, retinal disorders, retinoschisis and retinal cysts, rosacea, tobacco use disorder, type 1 diabetes nephropathy, varicose veins, varicose veins of lower extremity, visual disturbances