rs900947 chr3:137032618 A>T
- Sequence
agttcccggagacgccactaggtg[A/T]caatgtaggtcttggttggtcaac
- ASB in cell types
- PC9 (lung adenocarcinoma) suprapubic skin MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | -3.00 | 2.66 | 2.00 | |||
| suprapubic skin | n/a | 2.47 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.16 | 0.59 | 1.47 | |||
| HEK293 (embryonic kidney) | 0.13 | 0.67 | 1.45 | |||
| LNCaP C4-2B (prostate carcinoma) | 0.50 | n/a | 1.50 |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), height, ldl cholesterol, obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cortex, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood