rs9266382 chr6:31367100 A>C
- Sequence
gtggtcgatgcgcttcctttgcag[A/C]tcacgcacagccctgagatccacc
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) lower leg skin kidney
- ASB for transcription factors
- MNT_HUMAN NRF1_HUMAN ZNF24_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | -0.49 | 1.47 | 2.47 | n/a | n/a | |||
| NRF1_HUMAN | -0.59 | 1.67 | 2.00 | n/a | No Hit | |||
| ZNF24_HUMAN | 0.05 | 1.79 | 2.48 | n/a | n/a | |||
| RAD21_HUMAN | 0.15 | 1.37 | 1.67 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, college completion, height, triglycerides, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood