rs9321490 chr6:135173737 T>C
- Sequence
aggcctgagattgccaatggtttt[T/C]tgggggaggaaacagagtgaacag
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.16 | 0.74 | 1.57 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, fasting blood glucose, homa-ir, ldl cholesterol change with statins, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), multiple sclerosis, red blood cell count (rbc)
PheWAS abnormal involuntary movements, acute pericarditis, acute reaction to stress, acute sinusitis, acute upper respiratory infections, adverse effects of antilipemic and antiarteriosclerotic drugs, adverse effects of antirheumatics, agorophobia, social phobia, and panic disorder, allergy to serum or vaccine, anomalies of pupillary function, arterial embolism and thrombosis, arterial embolism and thrombosis of lower extremity artery, astigmatism, back pain, bacterial enteritis, benign neoplasm of eye, benign neoplasm of lip, oral cavity, and pharynx, benign neoplasm of uterus, blindness and low vision, bronchopneumonia and lung abscess, cancer of connective tissue, cellulitis and abscess of face, chondrocalcinosis, contact dermatitis and other eczema due to plants [except food], corneal degenerations, crystal arthropathies, degeneration of intervertebral disc, dental caries, diseases of hard tissues of teeth, diseases of nail, diseases of pulp and periapical tissues, disorders of cornea, endometriosis, gastroparesis, gestational diabetes, glycosuria or acetonuria, infertility, female, infestation, intervertebral disc disorders, joint effusions, joint/ligament sprain, lack of coordination, mastodynia, meningitis, noninflammatory disorders of vagina, other conditions of the mother complicating pregnancy, other congenital anomalies, other disorders of biliary tract, other specified diseases of nail, other specified diseases of the salivary glands, pallor and flushing, paralytic ileus, paraproteinemia, periapical abscess, poisoning by analgesics, antipyretics, and antirheumatics, polyarthropathy or polyarthritis involving multiple sites nos, pseudomonal pneumonia, unequal leg length (acquired), unspecified polyarthropathy or polyarthritis, urinary obstruction, viral hepatitis, viral hepatitis c
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Whole_Blood