rs9923231 chr16:31096368 C>T
- Sequence
attataggcgtgagccaccgcacc[C/T]ggccaatggttgtttttcaggtct
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | -1.91 | 1.84 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
PheWAS abnormal pulmonary function, acute laryngitis and tracheitis, acute periodontitis, aplastic anemia, atrial fibrillation & flutter, calcaneal spur, exostosis nos, calculus of lower urinary tract, cardiac conduction disorders, cardiac pacemaker in situ, cardiac pacemaker/device in situ, cataract, cerebral aneurysm, complications of transplants and reattached limbs, conduct disorders, congenital anomalies of the eye, cysts of the jaws, decreased white blood cell count, dementias, disorders of fluid, electrolyte, and acid-base balance, effects of radiation nos, flat foot, heart failure, hemorrhage of gastrointestinal tract, hyperglyceridemia, hyperventilation, hypopotassemia, iatrogenic hypothyroidism, inflammatory disease of breast, joint effusions, liver abscess and sequelae of chronic liver disease, lymphosarcoma, mucous polyp of cervix, myeloid leukemia, orthostatic hypotension, osteoarthrosis of multiple sites, other conditions of brain, nos, pancytopenia, pelvic inflammatory disease, pleurisy, pleural effusion, polyarthropathy or polyarthritis involving multiple sites nos, polyneuropathy in diabetes, premenstrual tension syndromes, primary pulmonary hypertension, rhabdomyolysis, sicca syndrome, subarachnoid hemorrhage, temporomandibular joint disorders, thyrotoxicosis, type 2 diabetic peripheral circulatory disorders, unspecified polyarthropathy or polyarthritis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood