rs10002833 chr4:185597765 T>C
- Sequence
ttaagcagagatttgtaatgcagc[T/C]gcactctgtcgccacctagtggtg
- ASB in cell types
- erythroid progenitors epidermal keratinocytes neutrophils from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 3.40 | n/a | 2.00 | |||
| epidermal keratinocytes | 3.34 | n/a | 2.00 | |||
| neutrophils from periferal blood | 2.05 | -0.74 | 1.50 |
Items per page:
1 – 3 of 3