rs10021129 chr4:140851175 G>A
- Sequence
tcaaagtagaatccaaaaaactct[G/A]ttccctaacgccagggcatctttt
- ASB in cell types
- MCF10AT1 (breast premetastatic epithelial cells) THP-1 (acute monocytic leukemia) ascending aorta
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10AT1 (breast premetastatic epithelial cells) | -2.06 | 2.44 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.96 | 1.06 | 1.00 | |||
| ascending aorta | 1.80 | -1.50 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp), triglycerides change with statins