rs1004873 chr19:8154949 A>G
- Sequence
atgcctgcagtctatggtgtgtgg[A/G]gtgcgctgggccagcctaggccag
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.10 | 0.64 | 1.95 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol change with statins, resistance to kuru in aged women despite likely exposure, schizophrenia, total cholesterol change with statins