rs10062606 chr5:29262893 A>G
- Sequence
gtatttcaaatagtactgccttga[A/G]tcattctcagggtaaagttacatc
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- SMCA4_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 0.34 | 2.25 | 1.00 | n/a | n/a | |||
| CEBPB_HUMAN | -0.03 | 1.61 | 1.69 | n/a | No Hit |
Items per page:
1 – 2 of 2