rs10065134 chr5:29176422 G>T
- Sequence
tggatttcaactgggtaaaaaagg[G/T]ggcaaagactttagaggataaaga
- ASB in cell types
- embryonic stem cells derived definitive endoderm
- ASB for transcription factors
- GATA6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | 0.09 | 1.46 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, college completion, ldl cholesterol, urinary albumin-to-creatinine ratio, years of education