rs10081557 chr8:67462980 T>C
- Sequence
caaatgacctaacttaaagcctca[T/C]agtggtaacaagattttacattta
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7 WS8 cells breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.04 | 0.94 | 2.48 | |||
| MCF7 WS8 cells | 0.15 | 0.97 | 2.00 | |||
| breast tumor | 1.54 | -3.68 | 2.00 |
Items per page:
1 – 3 of 3