rs10087621 chr8:122936219 T>G
- Sequence
cctctcacagttcactcccagttt[T/G]tgcagggaggtgttgaagacaggg
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 0.33 | 2.08 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol change with statins, height, ldl cholesterol, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), rheumatoid arthritis, total cholesterol, years of education