rs10133682 chr14:90114698 T>A
- Sequence
ctgggcagggattttgttccatgc[T/A]tctttgtgtctccaccaccaggag
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) MCF7 (Invasive ductal breast carcinoma) HCT-116 (colon carcinoma) bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.42 | 1.76 | 1.29 | n/a | No Hit | |||
| RAD21_HUMAN | -0.18 | 1.95 | 1.38 | n/a | n/a |
Items per page:
1 – 2 of 2