rs10206788 chr2:37829260 A>G
- Sequence
aataaaaattacctcagttcgtga[A/G]aacagcaaagatgtgtggcatgac
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- CDK8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK8_HUMAN | -0.74 | 1.84 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), arthritis including non-rheumatoid, childhood acute lymphoblastic leukemia, late onset alzheimers disease, microalbuminuria, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, salmonella-induced pyroptosis, urinary albumin-to-creatinine ratio